• Assay Principle

    MiRXES ID3EAL miRNA qPCR solution adopts a 3-specific assay priming strategy. The conformational-restricted miRNA-specific RT primer efficiently hybridizes to the mature but not the precursor form of the target miRNA. Specific qPCR forward and reverse primers confer further amplification specificity. Coupled with high performance proprietary ID3EAL RT and qPCR master mixes, robust amplification can be completed in just 2 hours with enhanced signal-to-noise ratio.

    .
  • Fast and Simple Workflow

    MiRXES ID3EAL miRNA Assay workflow illustration.
    Fast and simple workflow to get from RNA-to-Ct in just 2 hours, allowing for fast turnaround and improved throughput.
    Allows multiplexing of the reverse transcription step (up to 10 targets) to enhance the assay specificity

    .
  • Superior Sensitivity

    MiRXES ID3EAL miRNA qPCR Solution is designed to offer superior sensitivity, a broad dynamic range, and high amplification efficiencies consistently even in difficult samples such as plasma.

    Single base differences frequently occur, especially in miRNAs that are closely related, and poses a common challenge in miRNA quantification. Utilizing the unique 3-specific primers strategy, MiRXES ID3EAL miRNA qPCR Solution enables discrimination of highly homologous miRNA family members with single nucleotide difference.

    Comparison of Ct values obtained for five miRNA targets with a range of AT contents across four different vendors. MiRXES ID3EAL miRNA PCR Solution showed the highest performance with significantly earlier Ct values emerging for all miRNA targets tested as compared to other vendors. The proprietary MiRXES ID3EAL Assays Algorithm allows the design of robust assays that work with difficult miRNA targets giving users the confidence in their profiling data.

    MiRXES ID3EAL miRNA qPCR Solution detected >450 miRNAs whereas less than 100 miRNAs were reliably detected by other platforms in equivalent volume of serum samples (i.e. 200μL).
  • Superior Specificity

    Single base differences frequently occur, especially in miRNAs that are closely related, and poses a common challenge in miRNA quantification. Utilizing the unique 3-specific primers strategy, MiRXES ID3EAL miRNA qPCR Solution enables discrimination of highly homologous miRNA family members with single nucleotide difference.

    Single Nucleotide Discrimination Test. Synthetic cDNAs, representing the various isoforms of the highly homologous let-7 miRNA family, were used as templates to challenge assay specificity. The percentage relative detection was calculated from the Ct values collected from matched and mismatched assays. Using MiRXES proprietary thermodynamics based algorithms, MiRXES ID3EAL microRNA qPCR Solution was able to deliver specificity down to a single base difference, with little to no assay cross-reactivity. Sequences of the targets are shown on the left with base changes highlighted in orange and green.
  • ID3EAL Individual miRNA RT Primer 1-plex (20) - RNA5S1

    1103111-HSA0233631Z
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0233631Z, hsa-RNA5S1, NR_023363.1, microRNA Seq: GTCTACGGCCATACCACCCTGAACGCGCCCGATCTCGTCTGATCTCGGAAGCTAAGCAGGGTCGGGCCTG
    GTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGGGTGCTGTAGGCTTT, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000062A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000062A, hsa-let-7a-5p, MIMAT0000062, microRNA Seq: UGAGGUAGUAGGUUGUAUAGUU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004481A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004481A, hsa-let-7a-3p, MIMAT0004481, microRNA Seq: CUAUACAAUCUACUGUCUUUC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0010195A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0010195A, hsa-let-7a-2-3p, MIMAT0010195, microRNA Seq: CUGUACAGCCUCCUAGCUUUCC, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000063A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000063A, hsa-let-7b-5p, MIMAT0000063, microRNA Seq: UGAGGUAGUAGGUUGUGUGGUU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004482A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004482A, hsa-let-7b-3p, MIMAT0004482, microRNA Seq: CUAUACAACCUACUGCCUUCCC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000064A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000064A, hsa-let-7c-5p, MIMAT0000064, microRNA Seq: UGAGGUAGUAGGUUGUAUGGUU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0026472A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0026472A, hsa-let-7c-3p, MIMAT0026472, microRNA Seq: CUGUACAACCUUCUAGCUUUCC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000065A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000065A, hsa-let-7d-5p, MIMAT0000065, microRNA Seq: AGAGGUAGUAGGUUGCAUAGUU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004484A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004484A, hsa-let-7d-3p, MIMAT0004484, microRNA Seq: CUAUACGACCUGCUGCCUUUCU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000066A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000066A, hsa-let-7e-5p, MIMAT0000066, microRNA Seq: UGAGGUAGGAGGUUGUAUAGUU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004485A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004485A, hsa-let-7e-3p, MIMAT0004485, microRNA Seq: CUAUACGGCCUCCUAGCUUUCC, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000067A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000067A, hsa-let-7f-5p, MIMAT0000067, microRNA Seq: UGAGGUAGUAGAUUGUAUAGUU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004486A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004486A, hsa-let-7f-1-3p, MIMAT0004486, microRNA Seq: CUAUACAAUCUAUUGCCUUCCC, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004487A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004487A, hsa-let-7f-2-3p, MIMAT0004487, microRNA Seq: CUAUACAGUCUACUGUCUUUCC, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000068A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000068A, hsa-miR-15a-5p, MIMAT0000068, microRNA Seq: UAGCAGCACAUAAUGGUUUGUG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004488A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004488A, hsa-miR-15a-3p, MIMAT0004488, microRNA Seq: CAGGCCAUAUUGUGCUGCCUCA, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000069A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000069A, hsa-miR-16-5p, MIMAT0000069, microRNA Seq: UAGCAGCACGUAAAUAUUGGCG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004489A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004489A, hsa-miR-16-1-3p, MIMAT0004489, microRNA Seq: CCAGUAUUAACUGUGCUGCUGA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000070A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000070A, hsa-miR-17-5p, MIMAT0000070, microRNA Seq: CAAAGUGCUUACAGUGCAGGUAG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000071A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000071A, hsa-miR-17-3p, MIMAT0000071, microRNA Seq: ACUGCAGUGAAGGCACUUGUAG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000072A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000072A, hsa-miR-18a-5p, MIMAT0000072, microRNA Seq: UAAGGUGCAUCUAGUGCAGAUAG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0002891A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0002891A, hsa-miR-18a-3p, MIMAT0002891, microRNA Seq: ACUGCCCUAAGUGCUCCUUCUGG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004490A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004490A, hsa-miR-19a-5p, MIMAT0004490, microRNA Seq: AGUUUUGCAUAGUUGCACUACA, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000073A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000073A, hsa-miR-19a-3p, MIMAT0000073, microRNA Seq: UGUGCAAAUCUAUGCAAAACUGA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004491A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004491A, hsa-miR-19b-1-5p, MIMAT0004491, microRNA Seq: AGUUUUGCAGGUUUGCAUCCAGC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000074A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000074A, hsa-miR-19b-3p, MIMAT0000074, microRNA Seq: UGUGCAAAUCCAUGCAAAACUGA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004492A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004492A, hsa-miR-19b-2-5p, MIMAT0004492, microRNA Seq: AGUUUUGCAGGUUUGCAUUUCA, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000075A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000075A, hsa-miR-20a-5p, MIMAT0000075, microRNA Seq: UAAAGUGCUUAUAGUGCAGGUAG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004493A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004493A, hsa-miR-20a-3p, MIMAT0004493, microRNA Seq: ACUGCAUUAUGAGCACUUAAAG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000076A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000076A, hsa-miR-21-5p, MIMAT0000076, microRNA Seq: UAGCUUAUCAGACUGAUGUUGA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004494A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004494A, hsa-miR-21-3p, MIMAT0004494, microRNA Seq: CAACACCAGUCGAUGGGCUGU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004495A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004495A, hsa-miR-22-5p, MIMAT0004495, microRNA Seq: AGUUCUUCAGUGGCAAGCUUUA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000077A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000077A, hsa-miR-22-3p, MIMAT0000077, microRNA Seq: AAGCUGCCAGUUGAAGAACUGU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004496A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004496A, hsa-miR-23a-5p, MIMAT0004496, microRNA Seq: GGGGUUCCUGGGGAUGGGAUUU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000078A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000078A, hsa-miR-23a-3p, MIMAT0000078, microRNA Seq: AUCACAUUGCCAGGGAUUUCC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000079A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000079A, hsa-miR-24-1-5p, MIMAT0000079, microRNA Seq: UGCCUACUGAGCUGAUAUCAGU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000080A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000080A, hsa-miR-24-3p, MIMAT0000080, microRNA Seq: UGGCUCAGUUCAGCAGGAACAG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004497A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004497A, hsa-miR-24-2-5p, MIMAT0004497, microRNA Seq: UGCCUACUGAGCUGAAACACAG, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004498A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004498A, hsa-miR-25-5p, MIMAT0004498, microRNA Seq: AGGCGGAGACUUGGGCAAUUG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000081A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000081A, hsa-miR-25-3p, MIMAT0000081, microRNA Seq: CAUUGCACUUGUCUCGGUCUGA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000082A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000082A, hsa-miR-26a-5p, MIMAT0000082, microRNA Seq: UUCAAGUAAUCCAGGAUAGGCU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004499A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004499A, hsa-miR-26a-1-3p, MIMAT0004499, microRNA Seq: CCUAUUCUUGGUUACUUGCACG, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000083A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000083A, hsa-miR-26b-5p, MIMAT0000083, microRNA Seq: UUCAAGUAAUUCAGGAUAGGU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004500A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004500A, hsa-miR-26b-3p, MIMAT0004500, microRNA Seq: CCUGUUCUCCAUUACUUGGCUC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004501A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004501A, hsa-miR-27a-5p, MIMAT0004501, microRNA Seq: AGGGCUUAGCUGCUUGUGAGCA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000084A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000084A, hsa-miR-27a-3p, MIMAT0000084, microRNA Seq: UUCACAGUGGCUAAGUUCCGC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000085A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000085A, hsa-miR-28-5p, MIMAT0000085, microRNA Seq: AAGGAGCUCACAGUCUAUUGAG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004502A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004502A, hsa-miR-28-3p, MIMAT0004502, microRNA Seq: CACUAGAUUGUGAGCUCCUGGA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004503A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004503A, hsa-miR-29a-5p, MIMAT0004503, microRNA Seq: ACUGAUUUCUUUUGGUGUUCAG, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000086A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000086A, hsa-miR-29a-3p, MIMAT0000086, microRNA Seq: UAGCACCAUCUGAAAUCGGUUA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000087A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000087A, hsa-miR-30a-5p, MIMAT0000087, microRNA Seq: UGUAAACAUCCUCGACUGGAAG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000088A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000088A, hsa-miR-30a-3p, MIMAT0000088, microRNA Seq: CUUUCAGUCGGAUGUUUGCAGC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000089A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000089A, hsa-miR-31-5p, MIMAT0000089, microRNA Seq: AGGCAAGAUGCUGGCAUAGCU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004504A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004504A, hsa-miR-31-3p, MIMAT0004504, microRNA Seq: UGCUAUGCCAACAUAUUGCCAU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000090A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000090A, hsa-miR-32-5p, MIMAT0000090, microRNA Seq: UAUUGCACAUUACUAAGUUGCA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004505A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004505A, hsa-miR-32-3p, MIMAT0004505, microRNA Seq: CAAUUUAGUGUGUGUGAUAUUU, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000091A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000091A, hsa-miR-33a-5p, MIMAT0000091, microRNA Seq: GUGCAUUGUAGUUGCAUUGCA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004506A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004506A, hsa-miR-33a-3p, MIMAT0004506, microRNA Seq: CAAUGUUUCCACAGUGCAUCAC, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004507A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004507A, hsa-miR-92a-1-5p, MIMAT0004507, microRNA Seq: AGGUUGGGAUCGGUUGCAAUGCU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000092A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000092A, hsa-miR-92a-3p, MIMAT0000092, microRNA Seq: UAUUGCACUUGUCCCGGCCUGU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004508A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004508A, hsa-miR-92a-2-5p, MIMAT0004508, microRNA Seq: GGGUGGGGAUUUGUUGCAUUAC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000093A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000093A, hsa-miR-93-5p, MIMAT0000093, microRNA Seq: CAAAGUGCUGUUCGUGCAGGUAG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004509A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004509A, hsa-miR-93-3p, MIMAT0004509, microRNA Seq: ACUGCUGAGCUAGCACUUCCCG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0026473A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0026473A, hsa-miR-95-5p, MIMAT0026473, microRNA Seq: UCAAUAAAUGUCUGUUGAAUU, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000094A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000094A, hsa-miR-95-3p, MIMAT0000094, microRNA Seq: UUCAACGGGUAUUUAUUGAGCA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000095A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000095A, hsa-miR-96-5p, MIMAT0000095, microRNA Seq: UUUGGCACUAGCACAUUUUUGCU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004510A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004510A, hsa-miR-96-3p, MIMAT0004510, microRNA Seq: AAUCAUGUGCAGUGCCAAUAUG, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000096A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000096A, hsa-miR-98-5p, MIMAT0000096, microRNA Seq: UGAGGUAGUAAGUUGUAUUGUU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0022842A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0022842A, hsa-miR-98-3p, MIMAT0022842, microRNA Seq: CUAUACAACUUACUACUUUCCC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000097A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000097A, hsa-miR-99a-5p, MIMAT0000097, microRNA Seq: AACCCGUAGAUCCGAUCUUGUG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004511A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004511A, hsa-miR-99a-3p, MIMAT0004511, microRNA Seq: CAAGCUCGCUUCUAUGGGUCUG, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000098A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000098A, hsa-miR-100-5p, MIMAT0000098, microRNA Seq: AACCCGUAGAUCCGAACUUGUG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004512A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004512A, hsa-miR-100-3p, MIMAT0004512, microRNA Seq: CAAGCUUGUAUCUAUAGGUAUG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004513A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004513A, hsa-miR-101-5p, MIMAT0004513, microRNA Seq: CAGUUAUCACAGUGCUGAUGCU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000099A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000099A, hsa-miR-101-3p, MIMAT0000099, microRNA Seq: UACAGUACUGUGAUAACUGAA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004514A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004514A, hsa-miR-29b-1-5p, MIMAT0004514, microRNA Seq: GCUGGUUUCAUAUGGUGGUUUAGA, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000100A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000100A, hsa-miR-29b-3p, MIMAT0000100, microRNA Seq: UAGCACCAUUUGAAAUCAGUGUU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004515A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004515A, hsa-miR-29b-2-5p, MIMAT0004515, microRNA Seq: CUGGUUUCACAUGGUGGCUUAG, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0009196A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0009196A, hsa-miR-103a-2-5p, MIMAT0009196, microRNA Seq: AGCUUCUUUACAGUGCUGCCUUG, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000101A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000101A, hsa-miR-103a-3p, MIMAT0000101, microRNA Seq: AGCAGCAUUGUACAGGGCUAUGA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000102A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000102A, hsa-miR-105-5p, MIMAT0000102, microRNA Seq: UCAAAUGCUCAGACUCCUGUGGU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004516A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004516A, hsa-miR-105-3p, MIMAT0004516, microRNA Seq: ACGGAUGUUUGAGCAUGUGCUA, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000103A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000103A, hsa-miR-106a-5p, MIMAT0000103, microRNA Seq: AAAAGUGCUUACAGUGCAGGUAG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004517A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004517A, hsa-miR-106a-3p, MIMAT0004517, microRNA Seq: CUGCAAUGUAAGCACUUCUUAC, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000104A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000104A, hsa-miR-107, MIMAT0000104, microRNA Seq: AGCAGCAUUGUACAGGGCUAUCA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004518A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004518A, hsa-miR-16-2-3p, MIMAT0004518, microRNA Seq: CCAAUAUUACUGUGCUGCUUUA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000222A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000222A, hsa-miR-192-5p, MIMAT0000222, microRNA Seq: CUGACCUAUGAAUUGACAGCC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004543A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004543A, hsa-miR-192-3p, MIMAT0004543, microRNA Seq: CUGCCAAUUCCAUAGGUCACAG, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000226A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000226A, hsa-miR-196a-5p, MIMAT0000226, microRNA Seq: UAGGUAGUUUCAUGUUGUUGGG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0022691A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0022691A, hsa-miR-197-5p, MIMAT0022691, microRNA Seq: CGGGUAGAGAGGGCAGUGGGAGG, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000227A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000227A, hsa-miR-197-3p, MIMAT0000227, microRNA Seq: UUCACCACCUUCUCCACCCAGC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000228A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000228A, hsa-miR-198, MIMAT0000228, microRNA Seq: GGUCCAGAGGGGAGAUAGGUUC, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000231A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000231A, hsa-miR-199a-5p, MIMAT0000231, microRNA Seq: CCCAGUGUUCAGACUACCUGUUC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000232A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000232A, hsa-miR-199a-3p, MIMAT0000232, microRNA Seq: ACAGUAGUCUGCACAUUGGUUA, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0026474A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0026474A, hsa-miR-208a-5p, MIMAT0026474, microRNA Seq: GAGCUUUUGGCCCGGGUUAUAC, Lead time 21-35 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000241A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000241A, hsa-miR-208a-3p, MIMAT0000241, microRNA Seq: AUAAGACGAGCAAAAAGCUUGU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0000242A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0000242A, hsa-miR-129-5p, MIMAT0000242, microRNA Seq: CUUUUUGCGGUCUGGGCUUGC, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004548A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004548A, hsa-miR-129-1-3p, MIMAT0004548, microRNA Seq: AAGCCCUUACCCCAAAAAGUAU, Lead time 7-21 days
  • ID3EAL Individual miRNA RT Primer 1-plex (20)

    1103111-HSA0004549A
    20 µl of ID3EAL miRNA RT Primer (20x), UID: HSA0004549A, hsa-miR-148a-5p, MIMAT0004549, microRNA Seq: AAAGUUCUGAGACACUCCGACU, Lead time 21-35 days